Guide RNA

Guide RNA

Guide RNA is the RNA that guides the insertion of uridines into mRNAs in trypanosomes in a process known as RNA editing. These are encoded at distant regions of the kinetoplast genome. The 5' end of a gRNA hybridizes to a short region of an unedited pre-mRNA, called an anchor sequence, while its 3' end functions as a template for the editing process. Many gRNAs do not hybridize to anchor sequences in the primary transcript, but rather to sequences in partially edited intermediates. Thus editing of a trypanosome pre-mRNA generally starts near the 3' end and progresses towards the 5' end in a repetitive process that requires several different gRNAs, which bind sequentially to anchor sequences in previously edited sections.(molecular cell biology lodish et al. 2004)

It is not clear why trypanosome kinetoplasts utilize such an elaborate mechanism to produce mRNAs. The finding that RNA editing is most extensive in the earliest trypanosomes to have evolved suggests that this process may be a "molecular fossil" of the mechanism of RNA synthesis during an early stage in the evolution of modern cells. Fact|date=October 2007

Overview of gRNA-mediated editing

The mitochondria for some trypanosome protozoa undergo gRNA-mediated mRNA editing. The gRNA identifies particular sequences and inserts or deletes Uridine (U) nucleotides. The edited portion of the mRNA is in the coding region, which has the effect of modifying the protein that is produced.

Example of gRNA-mediated editing

In the protozoan, "Leishmania tarentolae", some mitochondrial genes are edited using this process. One such gene is Cyb. [See [http://dna.kdna.ucla.edu/trypanosome/index.html] (Accessed 19 May 2006) for details.] While the exact sequence of events is still under study, one model has that the mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is

mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'

The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) with normal basepairing (some G/U pairs are used). The 5' end does not exactly match and an endonuclease makes cuts in the mRNA to allow for alignment.

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3'

The mRNA is now "repaired" by adding U, giving the sequence

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'

This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).

Notes


Wikimedia Foundation. 2010.

Игры ⚽ Нужно решить контрольную?

Look at other dictionaries:

  • guide RNA — guide RNA. См. руководящая РНК. (Источник: «Англо русский толковый словарь генетических терминов». Арефьев В.А., Лисовенко Л.А., Москва: Изд во ВНИРО, 1995 г.) …   Молекулярная биология и генетика. Толковый словарь.

  • guide RNA — An RNA molecule that contain sequences that function as a template during RNA editing. See: guide sequence …   Glossary of Biotechnology

  • guide RNA — Small RNA molecules that hybridize to specific mRNAs and direct their RNA editing …   Dictionary of molecular biology

  • Guide RNA — …   Википедия

  • RNA interference — (RNAi) is a mechanism that inhibits gene expression at the stage of translation or by hindering the transcription of specific genes. RNAi targets include RNA from viruses and transposons (significant for some forms of innate immune response), and …   Wikipedia

  • RNA — For other uses, see RNA (disambiguation). A hairpin loop from a pre mRNA. Highlighted are the nucleobases (green) and the ribose phosphate backbone (blue). Ribonucleic acid (English pronunciation: /raɪbɵ.njuːˌkleɪ.ɨk ˈæsɪd/), or RNA, is one of… …   Wikipedia

  • RNA editing — The term RNA editing describes those molecular processes in which the information content in an RNA molecule is altered through a chemical change in the base makeup. To date, such changes have been observed in tRNA, rRNA, and mRNA molecules of… …   Wikipedia

  • RNA editing — A process responsible for changes in the final sequence of mRNA that are not coded in the DNA template. Excludes mRNA splicing and modifications to tRNA. Various kinds of editing are known, the commonest being cytidine (C) to uridine (U)… …   Dictionary of molecular biology

  • RNA-Editing — (deutsch: RNA Editierung) ist ein biochemischer Vorgang innerhalb bestimmter Zellen oder Zellorganellen, der im Verlauf der Genexpression nach der Transkription und vor der Translation stattfinden kann. Der Begriff beschreibt die Modifizierung… …   Deutsch Wikipedia

  • RNA-Edition — RNA Editing (deutsch: RNA Edition) ist ein biochemischer Vorgang innerhalb bestimmter Zellen oder Zellorganellen, der im Verlauf der Genexpression nach der Transkription und vor der Translation stattfinden kann. Der Begriff beschreibt die… …   Deutsch Wikipedia

Share the article and excerpts

Direct link
Do a right-click on the link above
and select “Copy Link”