- Guide RNA
Guide RNA is the
RNA that guides the insertion ofuridine s intomRNA s intrypanosome s in a process known asRNA editing . These are encoded at distant regions of thekinetoplast genome. The5' end of a gRNA hybridizes to a short region of an uneditedpre-mRNA , called ananchor sequence , while its3' end functions as a template for the editing process. Many gRNAs do not hybridize to anchor sequences in the primary transcript, but rather to sequences in partially edited intermediates. Thus editing of a trypanosome pre-mRNA generally starts near the 3' end and progresses towards the 5' end in a repetitive process that requires several different gRNAs, which bind sequentially to anchor sequences in previously edited sections.(molecular cell biology lodish et al. 2004)It is not clear why trypanosome kinetoplasts utilize such an elaborate mechanism to produce mRNAs. The finding that RNA editing is most extensive in the earliest trypanosomes to have evolved suggests that this process may be a "molecular fossil" of the mechanism of RNA synthesis during an early stage in the
evolution of modern cells. Fact|date=October 2007Overview of gRNA-mediated editing
The
mitochondria for some trypanosomeprotozoa undergo gRNA-mediated mRNA editing. The gRNA identifies particular sequences and inserts or deletes Uridine (U) nucleotides. The edited portion of the mRNA is in the coding region, which has the effect of modifying the protein that is produced.Example of gRNA-mediated editing
In the protozoan, "Leishmania tarentolae", some mitochondrial genes are edited using this process. One such gene is Cyb. [See [http://dna.kdna.ucla.edu/trypanosome/index.html] (Accessed 19 May 2006) for details.] While the exact sequence of events is still under study, one model has that the mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is
mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'
The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) with normal basepairing (some G/U pairs are used). The 5' end does not exactly match and an
endonuclease makes cuts in the mRNA to allow for alignment.gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3'
The mRNA is now "repaired" by adding U, giving the sequence
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'
This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).
Notes
Wikimedia Foundation. 2010.