- Subgenomic mRNA
Subgenomic mRNA's are essentially smaller sections of the original transcribed
template strand . Duringtranscription , the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the 5' end of the template, creating a 3' tail for the newly created strand. As a result, the newly created strand will have similar 5' ends to varying degrees with the original template (depending on when the transcription began the jump) and similar 3' ends to the template [Wu B, White KA. "Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights." EMBO J. 2007 Nov 22] .The result is many different
proteins created from the different lengths of mRNA created from the same strand with similar 5' ends (to varying degrees) and same 3' ends. The similar 5' sections on the newly created strand is a result of the same section being copied from the template strand, and this section on the template strand is referred to as the "nested set" [Le TM, Wong HH, Tay FP, Fang S, Keng CT, Tan YJ, Liu DX. "Expression, post-translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus." FEBS J. 2007 Aug;274(16):4211-22. Epub 2007 Jul 20.] .GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original Strand GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACAAAAAAAAA
GCCGCCCCGTATCGATCGTAGCGCACAAAAAAAAA | = Subgenomic mRNA GCCGCCCCGTATAAAAAAAAA
GCCGCCCCGTAT = Nested SetExamples
This complex method of transcription is generally restricted to
virus es, especially those of the single-stranded, positive-senseRNA or Class IV viruses using theBaltimore Classification System . Its use is primarily used for compacting moregenetic information into a shorter amount of genetic material [Xu W, White KA. "Subgenomic mRNA transcription in an aureusvirus: Down-regulation of transcription and evolution of regulatory RNA elements." Virology. 2007 Nov 5] .Literature
please correct the references; it is 26 not 22 volumethe first one is:Wu, Baodong & White, K.A. 2007. Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights. The EMBO Journal. 26, 5120–5130
Wikimedia Foundation. 2010.
